Document Type : Short communication
Brucellosis is zoonotic diseases which made health and economic problem in many countries 1. In industrialized nations because of routine screening of domestic livestock and animal vaccination brucellosis in humans and livestock are relatively uncommon. Up to now no human vaccines are available, and current animal vaccines are both virulent in humans and lack clinical efficacy 2. Therefore, an efficient, economical and easily managed vaccine needs to be developed.
Researchers revealed that Brucella melitensis (B. melitensis) bp26 gene is a good immunogen and can be candidate for Brucella spp vaccine 3. This gene encoding the 28 kDa periplasmic protein is named BP26, CP28 or Omp28 and is a target molecule to detect anti-Brucella antibodies 4,5. To date, Lactococcus lactis (L. lactis) is attractive live delivery vector through mucosal routes for delivering bioactive proteins. L. lactis enters through M cells and multiplied within phagocytic cells so releasing and spreading in deeper layer was occurred. Therefore induction of immune responses against L. lactis antigens was Getting Started 6-10. PNZ8149 was used as the broad host range vector. This vector produces a cytoplasmic protein and to prevent protein removal by digestive enzymes or by other factors in the digestive tract, this protein was not designed to be secreted or attached to the cell surface of bacteria. Therefore, after entering of this recombinant bacterium through the M cells and up taking via phagocytic cells, the probability of induction the immune system, through BP26 protein, is higher 10.
In this study for first time, B. mellitensis bp26 gene was cloned into the PNZ 8149 vector and expressed in L. lactis NZ 3900 for used as a research experimental tool to find a good vaccine candidate.
Bacterial strains and growth conditions: Any bacterial strains and plasmids used in this study are showed in table 1. All L. lactis strains were grown at 30oC on M17 media (Merck, Germany) containing 0.5% glucose (M17-glu) or lactose (M17-lac). All Escherichia coli (E. coli) DH5α strain were grown at 37oC on Luria-Bertani (LB) medium (Merck, Germany) containing 50 μg/ml Ampicillin or 50 μg/ml kanamycin.
Amplification of bp26 gene: To amplify the bp26 gene, one pair of PCR primers was designed based on sequences published in Gene Bank (accession No. JF918758.1), and the restriction endonuclease sites of XbaI and SphI were added to both ends of the modified bp26 protein gene e based on the structure of PNZ8149 (forward: GCATGCA TGAACACTCGTGC and reverse: TCTAGATTACTTGATTTCAAAAACGAC). Template DNA (pET28a+bp26) preserved by Our lab 3. The PCR was performed initial denaturation at 95oC for 2 min, followed by 34 cycles of 95oC for 1 min, 58oC for 1 min, and 72oC for 1 min. with Extra polymerization in 72oC for 30 min. The PCR product consisting 753 bp was checked using agarose gel electrophoresis and then purified using a Fermentas Silica Bead DNA Gel Extraction Kit.
Cloning and transformation: The PCR product was cloned in to pTZ57R/T vector and transformed in E. coli DH5α competent cells. The recombinant pTZ57R/T plasmid was extracted and digested with two restriction enzymes (SphI /NEB Bio lab and XbaI/Fermentas Digestion Enzyme). At the same time the pNZ8149 plasmid was digested with both SphI and XbaI and purified. The purified desire was inserted into the pNZ8149. Competent L. lactis NZ39000 cells were then electro-transformed with the recombinant plasmids (Gene e-Pulser; Bio-Rad, Hercules, CA, USA) and cultured on Elliker agar-lac bromocresol purple and incubated at 30oC for 48 hr. Transformants harboring the recombinant plasmids were verified through enzymatic digestion and PCR.
Expression of recombinant protein: Expression performed according to MoBiTec NICE_Expression_System and analyzed on 10% SDS- PAGE. To confirm the accuracy of the SDS-Page and protein expression, Western Blot was performed with Nitrocellulose Membrane (Sigma) and using the Trans-Blot SD cell (BIO-RAD). After blocking with TBST (tris-buffered saline, 0.05% Tween-20) buffer containing 5% skimmed milk at 4°C overnight, the membranes were incubated with a mouse IgG monoclonal antibody, anti- OMP28, (MyBioSource, Inc, USA) at a dilution 1:500 in phosphate-buffered saline (PBS) at a 37°C for 60 min. Then, the blots were washed and incubated with 1:2000 dilution of HRP-conjugated rabbit anti-mouse IgG (MyBioSource, Inc, USA) for 60 min. Binding was visualized using diaminobenzidine (Merck), according to the manufacturer's instruction.
PCR screening: Results showed that the expected DNA band of the bp26 gene had been amplified; the PCR product was approximately 753 bp in length plus the 12 bp restriction sites (Figure 1).
Digestion screening: Double-digestion confirms the size of bp26 gene (Figure 2).
Induced expression of the recombinant L. lactis: Results of bp26 gene expression on SDS-PAGE; as it is evident in the figure, with increasing Nisin (1 ng/ml) addition time, the amount of protein expression also increases. Protein production increase with Nisin and in 5th hr the high level of protein production was seen. Results indicated that the molecular weight of the expressed recombinant protein was approximately 28 kDa (Figure 4).
Western blot results showed that the produced protein was the B. melitensis omp28 (Figure 5). The result show that the binding of BP26 protein and its antibody occurred.
Brucellosis is a worldwide zoonotic disease, which remain an important public health concern and causes economic losses in endemic areas 11,12. Vaccination is the most possible way to reduce the transmission in domestic animal herds and humans. The infectious cycles of most pathogenic micro-organisms initiate from mucosal surfaces. So, if colonization and invasion of infectious agents stopped in this stage, the infection does not happen. For this purpose, a vaccine must be made to stimulate mucosal and cellular immunity 13-15. Today, investigations showed that using Lactic Acid Bacteria (LAB) as a live delivery vectors for antigens can induce mucosal immunity and one of the most important candidates to produce mucosal vaccines. In this investigation, we used L. lactis 3900 as a gene delivery vehicle. Despite the fact that L. lactis is a non-commensal and non-colonizing bacterium at the level of the gastrointestinal tract, it can be easily taken up by M cells, and exhibits adjuvant/immune potentiating activity 16,17. As Brucella infections involve mainly bacterial entry through the mucosal routes, the development of successful approaches for oral vaccination could radically alter the current scene of brucellosis 18,19. Most published studies have evaluated the use of live vectors expressing Brucella antigens for vaccine delivery at the mucosal gut. At present, several recombinant proteins of Brucella have been evaluated as oral vaccine with L. lactis and sufficient evidence showed that they can induce protective immunity in mice 19-23. For example, in 2002, Luciana A. Ribeiro et al expressed Brucella abortus L7/L12 gene in L. lactis, under the nisin-inducible promoter 22. In another work, Daniela S. Pontes et al in 2003, revealed that a recombinant Lactococcus lactis strain producing L7/L12 under the control of nisin inducible promoter when orally administered to BALB/c mice, they could induced local humoral immune response and detected significant levels of anti-L7/L12 specific IgA in feces 21.
In 2012 DarwinSáez et al, transformed Brucella abortus (B. abortus) Cu-Zn Superoxide dismutase (SOD) in L. lactis and revealed that orally vaccinated mice protected against challenge with the virulent B. abortus 2308 strain 19.
According to the investigations which mentioned above and considering that B. melitensis BP26 is a good immunogenic protein 24, in this study, we successfully constructed a food-grade recombinant L. lactis producing the B. melitensis BP26 protein for future researches about induction of immune response by this protein.
The authors thank Dr. Behrozikhah, Razi Vccine and Serum Research Institute, Agricultural Research, Education & Extension Organization, Karaj, Iran and Dr. Tavangar, Razi Vaccine and Serum Research Institute, Agricultural Research, Education & Extension Organization, Karaj, Iran for their constant support and guidance.